jboogiethegamer09 jboogiethegamer09
  • 21-10-2022
  • Mathematics
contestada

Solve. Your answer should be in simplest form. 2/5 (−3/7)

Respuesta :

Otras preguntas

Kim is paid $78 for 6.5 hours of work. What is her rate of pay per hour?
Help please !!!!!!!!
Hi! I need help with this question for my Algebra 1 class: Write the equation of the line;M=5; going through the point ( 7 , -1 )Any feedback is appreciated.
CREATIVE WRITING HELP PLEASE
PLEASE HELP!Suppose a civil war has just ended in one country and the United Nations agrees to send in Blue Berets to help keep the peace. How will the United N
With amendment allows elecotors to cast a separate ballots for president
Which event from a raisin in the sun is most likely meant to create a triumphant aesthetic impact?
if 375 miles in 5 hours how many miles per hour
DNA tacaggtacccgaacccaattta
what number is 23% of $115