thebigna thebigna
  • 21-12-2022
  • Mathematics
contestada

The functions f(x) and g(x) are shown on the graph.
f(x) = x²
What is g(x)?
10
A. g(x) = 2x²
B. g(x) = (x - 2)²
C. g(x) = (¹ x)²
D. g(x) = (x + 2)²
f(x)
(2,8)

Respuesta :

Otras preguntas

Make a word rearranging the following letters: C O P E S O R I M M
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
If 1+4=5 what is 8+11
In a parking lot there are motorcycles and cars. You count 98 wheels, and your friend counts 30 vehicles. How many cares are there? How many motorcycles? Assign
what finger does the ring go on
Which name does the monk who travels to the west not use
What is the second Vatican council?
Mrs. Gannon is having her class make a winter decorations using pine cones. If each decoration needs 11 pine cones and Mrs. Gannon ha 18 students in her class.
A carton measures 3 feet by 2 feet by 2 feet. A machine can fill the carton with packing material in 3 seconds. How long would it take to fill a carton that mea
Write an entry for your blog which describes a place you have visited which has affected you or stayed in your memory and explain why this is so