kaanan8459 kaanan8459

22-05-2023
Biology

contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

Which additional word or words in the sentence should be capitalized? The name for the Jewish holiday that celebrates a new year is rosh hashanah in hebrew. Cho

How are most stocks bought and sold? Mostly, individuals sell their stocks directly to other individuals. Most stocks are sold directly to investors by the issu

which is greater 6 km or 54,000 mm

The sale amount is $98.75. What is 5% sales tax? What is 8% sales tax? and what is 6.5% sales tax?

Which body of water borders the Persian homeland?

What was the myth and what was the reality of the “new woman” of the 1920s?

what is 5/12+1/4 equal to

PLZZZZZ HELP HURRY what guarantee gives accused individuals the rights to a hearing before being in jail A. bounties B. greenbacks C. draft D. habeas corpus

Evaluate d – 6.3 when d = 4.26. A. –10.56 B. –2.04 C. 2.04 D. 10.56

what two numbers multiply to get 36 add to -15