bestiesmkcp8376 bestiesmkcp8376

21-03-2024
Physics

contestada

Assuming a microwave oven operates at a frequency of 1.60 *10¹¹, what is the wavelength of this radiation in meters?

Respuesta :

Otras preguntas

The role of media on reporting human rights violation

the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch

how many atoms are present in 4.0 mol of sodium

Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.

what is the solution of the following question? x^2+10x+25=12

An ovule can be defined as:

governments may create what to discourage companies from producing negative externalities? Answer choices: benefits, revenues, or regulations

When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated

0-4+7-5×3÷9×5-4 do the sum of that mathematics...

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC