lorenzobail1806 lorenzobail1806
  • 24-03-2024
  • Mathematics
contestada

La question 2
Sa m'aiderai si quelqu'un répond avant demain

La question 2 Sa maiderai si quelquun répond avant demain class=

Respuesta :

Otras preguntas

Find the equation of a line that is parallel to y = 5x + 7 and passes through (4, 3).
what are the five key hr activities that help create an ethical climate
A plane has a mass of 41,000 kg. Use the information in the diagram below to find the acceleration of the plane.
Which of the following is an irrational number ? A) square root of 9 B) 1.9 C) square root of 67 D) square root of 81
All of the following are derived units except ________.
lesson 6.4NEED HELP!!!!!! Graph the image of the figure using the transformation given. last 3 pics are the options to choose from .
What are some examples today of corporations and politics colliding?
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Người ta thả x kilôgam bèo hoa dâu vào mội cái ao thì sau 6 ngày bèo phủ kính mặt ao. Biết rằng cứ sau mội ngày thì diện tích bèo tang lên gấp đôi. Hỏi lượng bè
Given the matrices A = 2 2 3 4 B= 0 4 2 -3 C= 4 6 5 6 the matrix X in the equation (x-4b)a=c