cindyrosas818 cindyrosas818

24-04-2024
Mathematics

contestada

Factory makes 1500 shirts every weekday the factory makes shirts for eight hours each workday and the fewest number of workdays. The factory will need to make 24,000 shirts.

Respuesta :

Otras preguntas

What is 1 1/2 as a percent

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

An advantage of the corporate form of organization is that a corporation:.

What are the domain and range of the function? f(x) =2√x

Fill In the Blanks nitrogen fixation is accomplished by specialized __________ in the soil and _______ in aquatic enviroments

The morning dewm Read the extract and answer the following questions: “Some questions always bother him.” a. Who is referred to as ‘him’ here? b. Jot down a que

ILL GIVE BRAINLIEST!! Solve for m. m + 15 < −1 2/3 m< −1 7/15 m> −1 13/15 m> −1 7/15 m < −1 13/15

Which particle is used as a beam to treat cancer? Please select the best answer from the choices provided A B C D

Please help! 9. Find the value of x in the triangle.

find the value of m 5m=10: which is the answer 2,50,5