Seudónimo Seudónimo
  • 22-02-2016
  • Mathematics
contestada

Which bigger 0.80 or 0.08

Respuesta :

saidania120303 saidania120303
  • 22-02-2016
0.80 because when you line up the decimals 0.80 is bigger

0.80
0.08
Answer Link
MiddleSchoolerAnnie MiddleSchoolerAnnie
  • 22-02-2016
0.08 because 0.08 the 8 is in the hundreths
Answer Link

Otras preguntas

Potassium is a silvery-white, solid metal. Chlorine is a greenish-yellow gas. When these two elements react chemically, they yield potassium chloride which is a
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
A king known as _____________ became a legendary figure in Sumerian literature.(Ur-Zababa OR Gilgamesh)
Convert each terminating decimal to a fraction in its simplest form.
Help me please ******
Calcula el valor de la velocidad de las ondas sonoras en el agua sabiendo que su densidad es 1.10 3 kg/m 3 y su módulo de comprensibilidad vale 2,16x10 9 N/m 2
If f(x) = -3 and g(x) = 4x2 + x - 4, find (f+9)(x). 2 A. X -1 A. 4x2 + 2x-1 B. 4x2 + -7 C. 4x2 +2x-1 7 X-1 D. 6x2 - 7
Can someone explain and answer this question please... I'm very unsure. please and thankyou
For a project in her Geometry class, Makayla uses a mirror on the ground to measure the height of her school building. She walks a distance of 13.75 meters from
Will mark brainly!! :)