XXXTENTACIONrip XXXTENTACIONrip

21-06-2018
History

contestada

what type of political party system is a dictatorship? A) multi party system B) dual party system C) no party system D) one party system

Respuesta :

Brandii23 Brandii23

21-06-2018

It might be B not sure

Answer Link

olsonrowyn olsonrowyn

21-06-2018

D, one party system. There is just one absolute authority figure. It's good to think of it as a small business. This will go lowest rank to highest:
1. Employees
2. Supervisors
3. Assistant Manager
4. Manager
5. Owner

Answer Link

Otras preguntas

What domain did sues rule?

Assuming the average composition of air weighs approximately 0.0807 lbs per cubic foot, what is the weight of air in a giant spherical balloon with a diameter o

what type of sentence tends to express a strong emotion

Prolonged use of antipsychotics may lead to ______ in adults..... extrapyramidal effects and tardive dyskinesia parkinsonism-like symptoms neither a or b both a

What is the most common cause of liver failure ?

1+4 = 5. 2+5=12. 3+6=21 8+11==?

when addressing an envelope for delivery in the united states or canada, the zip code should appear where

Consider the following piecewise-defined function. f(x){x^2 -5, x<3

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

of elements N, O, Cl, Na, and Which two would likely have similar chemical properties and why