caskyla caskyla

25-10-2018
Mathematics

contestada

A box of 15 cookies cost 8 dollars how much dies it cosy to buy 1 cookie

Respuesta :

xxmimi7xx xxmimi7xx

25-10-2018

Answer:

The answer is 1.875

Step-by-step explanation:

All you have to do is divide the two numbers 15 and 8 leading into one cookie

Answer Link

Otras preguntas

Air bags are activated when a severe impact causes a steel ball to compress a spring and electrically ignite a detonator cap. This causes sodium azide (NaN3) to

First Class, Inc., expects to sell 28,000 pool cues for $14 each. Direct materials costs are $3, direct manufacturing labor is $5, and manufacturing overhead is

If the distance from D to D' is 10 and the distance from A to D is 2 what is the scale factor?

Can someone help me? It's urgent and thank you!

I need help please.

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

Which of the following is an equation of the line that passes through the point (-2,3) and is perpendicular to the graph of the equation y = 3x - 2?

Which of these choices allows people to pass down survival techniques from one generation to the next? A. Communication B. Foraging C. Domestication D. Clothing

XYZ Corporation manufactures orange safety suits for road workers. The following information relates to the corporation's purchases and use of material for Apri

URGENT!! can someone give me tips for logarithms and how to solve them, i’m stuck!