mckaylaking8248 mckaylaking8248

21-04-2019
History

contestada

Which American chemists’ famous 1953 experiment produced the most commonly accepted theory on the origin of life?

James Hutton and Charles Darwin

Stanley L. Miller and Harold C. Urey

Harold C. Urey and James Hutton

Charles Darwin and Stanley L. Miller

Respuesta :

s418519 s418519

21-04-2019

Answer:

Stanley L. Miller and Harold C. Urey

Answer Link

Otras preguntas

Do any of these represent a linear function (just state letters if they do)

Please help me answer these questions

Perpendicular lines intersect to form __________________ angles

which simple machines is NOT a wedge?

1+4=5,2+5=12,3+6=21, 8+11=

7.8 14. Give the inequality 7.9 15. Make d the subject of the formula: A cd Anyone know the answers to these two questions?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

a water sample could be negative for enterococcus and coliforms and still be a major public health threat. why? Why can filitration be used to sterilize culture

how to solve these question?

Which sentence uses a verb that agrees with its subject? A. The time between Labor Day and Thanksgiving seem short. B. This map of the United States show