calderonjudith680 calderonjudith680
  • 23-05-2019
  • Biology
contestada

Snapdragons show co-dominance for red and white flower color. which of these would you expect to have dark red flowers?

Respuesta :

melodrama
melodrama melodrama
  • 23-05-2019

a flower homozygous for the red flower allele

Answer Link

Otras preguntas

What might "tangible artifacts" tell us about the Shang?
What's 165% as a fraction and decimal
During a cesarean section, an incision is made through all EXCEPT which of the following? A)linea alba B)perimetrium C)superficial fascia D)decidua basalis
Which of the following can increase your credit cards APR
1) A fashion designer makes and sells hats. The material for each hat costs $5.50. The hats sell for $12.50 each. The designer spends $1400 on advertising. How
Find the mean of these values 6,4,8,2,5
what would you call a object that makes people shut up
the combined land area of the countries A and B is 147,973 square kilometers. Country A is larger by 673 square kilometers. Determine the land area of each coun
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
which simple machines is NOT a wedge?