buddy79 buddy79
  • 21-06-2019
  • History
contestada

What is supply and demand ?

Respuesta :

mythwiz
mythwiz mythwiz
  • 21-06-2019

Answer:

the amount of a commodity, product, or service available and the desire of buyers for it, considered as factors regulating its price.

Explanation:

Answer Link
TheBlueFox
TheBlueFox TheBlueFox
  • 26-08-2019

Buying and selling things is based on supply and demand. Supply is the amount of goods and services there are to buy. Demand is how many people want to buy those goods and service. Supply can be big, small, or in between. Demand is high when people want to buy something and low when people don't want to buy it.

Answer Link

Otras preguntas

Find f(g(x)) if f(x) = 3x + 1 and g(x) = x2 - 1.
Find the unknown side length for the rectangle. Area = 27 in² A. 3 in. B. 6 in. C. 9 in. D. 24 in.
how to complete a coordinates table
what is the number of atoms per element with Cr(NH3)6(NO3)3
Max can spend up to $9 on lunch. He wants to buy a turkey sandwich, bottle of water, and x pounds of potato salad. Write and solve an inequality to find the pos
DNA tacaggtacccgaacccaattta
Why were laws passed that denied slaves many rights
(Opinion) How can leading with love help to promote safe communities?
How many members make up Maine’s senate?
Scott and his family want to hike a trail that is 1,365 miles long. They will hike equal parts of the trail on 12 different hiking trips. How many miles will Sc