20kalbrant 20kalbrant

23-10-2019
Health

contestada

Durning a test, it is generally best to?

Respuesta :

Аноним Аноним

23-10-2019

Answer:

During a test it is best to focuc and have a queit environment and at least 8 hrs of sleep in advance

Explanation:

Answer Link

Otras preguntas

Lin says that an octagon has six sides. Chris says that it has eight sides. Whose statement is correct?

How many troops from Paraguay entered the war? O 55,000 O 40,000 O 50,000 O 60,000

What is the approximate volume of 280 g of chlorine gas (Cl2) at STP?

Hayden went apple picking with his family. In his bag he had four Granny Smith apples, two Honeycrisp apples, three Gala apples, and one Fuji apple. What is th

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

What property of water allows the water to cover the astronauts hand?

Which property is being shown in this equation? 4(2n - 5) = 8n - 20 *CommutativeAssociativeIdentityDistributiveTransitive

How did Hitler break the Treaty of Versailles? He sent troops into the Rhineland He created the Anschluss (Austria and Germany united) He built up the military

A gemstone in the shape of a rhombus has the measurements shown. Match the measures with the angles.

Mark earns $440 per week. He receives a 20% raise. What is Mark's weekly pay rate?