luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

Last week Jane made deposits of $64,25,and$37 into her checking account.she then Wrote checks For $52 and $49. What is janes new account balance?
The energy in food molecules, such as glucose, is converted into__
someone help please will give brainliest
HELP QUICK PLEASE!! What ingredients are you unable to use in a stir-fry dish? WHY?
i will mark brainliest please help
Which of the following is an example of a statutory law? A. IRS regulatory rules and procedures B. A presidential executive order C. A court ruling overturning
what is photosynthesis​
1-6 please (there is a picture) ​
Heres a fact the last fact i know its maybe not true but the Goodyear Blimp is the official bird of Redondo Beach, California.
he steps below describe the construction of a line AG that is parallel to segment PQ and passes through a point A outside of PQ: Step 1 shows a segment PQ with