cretana107 cretana107
  • 25-04-2020
  • English
contestada

Please help. I’ll mark you as brainliest if correct!!!!

Please help Ill mark you as brainliest if correct class=

Respuesta :

SHEEPNOODLE
SHEEPNOODLE SHEEPNOODLE
  • 25-04-2020

7.) Transfer

The given scenario uses ideas of patriotism and freedom as propaganda

8.) Bandwagon

The given scenario brings up an idea similar to, "if everyone else wants to do it, why shouldn't you?". Bandwagon is, in a sense the peer pressure of literary devices.

Answer Link

Otras preguntas

how can I solve it which method should I use please answer me ! ​
should community service be mandatory
Someone pls pls pls solve this!!!!!!! And pls explain how u solved it. I need this due rn ASAP!!!
Quick please someone help!!! This is my last day to turn in work and if I don’t I’m getting my phone, tv and privileges to go hang out with friends taken away.
Anyone can help :(((:)
The graph below shows the solution to which system of inequalities?​
Keisha runs 3 miles in 25 minutes. At the same rate, how many miles would she run in 20 minutes?
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
What is the slope of the line?
Byron is working in a lab testing bacteria populations. After starting out with a population of 288 bacteria, he observes the change in population and notices