cellonoluck cellonoluck

26-04-2020
Spanish

contestada

Tengo que abordar el avión y salgo por la __________________. (1 point

Respuesta :

alejandra3738 alejandra3738

26-04-2020

I think the answer is puerta de emparque

Answer Link

melissa5576 melissa5576

25-03-2021

I’m not sure I need to do this for the point sorry

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

7. Which of the following rivers is the world's busiest waterway? A. Rhone B. Rhine C. Danube D. Seine

A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ

Why wood suitable to build boats and rafts

Which lines in this excerpt from Mary Otis Warren's poem "A Political Reverie" use figurative language? I look with rapture at the distant dawn , And view the g

How is the location of an electron described?

Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above

What name was given to the Allied plan to invade France?

Meaning of highland cow

list the six external parts of a computer system and identify which are output and which and which are input devices