kamaurinorwood kamaurinorwood

22-05-2020
Social Studies

contestada

Which term is used to describe the sparsely populated area of the Australian interior

Respuesta :

Аноним Аноним

22-05-2020

Answer: The Outback

Explanation: Mark me as the brainliest

Answer Link

Otras preguntas

All of the following changes to a metal are physical changes except.

Janet is playing a game in which she interacts with an environment to solve a puzzle and to meet new characters. She really enjoys this game because there are n

This is a spanish quiz on using the word tener pls help

4200 in the scientific notation.

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Throughout the essay, Alexander presents and then responds to the views of others. Find two examples where Alexander introduces the views of others. In each cas

. How should President Kennedy respond to the Soviet Arms Buildup in Cuba?

(1). What is the Capital of El Salvador?.(2). Where is located El Salvador?(3). Approximately, how many rivers does El Salvador have?(4). How many volcanoes doe

Sean received both the 5th highest and the 5th lowest mark in the class. How many students are there in the class?.

May anyone give me 3 points that I could include in my paragraph ( I agree with the statement) I need more ideas?