helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

A majorr change woman experience during the post World War I era was that they started

if you are stopped by a police officer for driving without having all passengers under the age of 18 properly restrained you can receive a citation and receive

Look at the underlined supporting details in paragraph 1. What is the unstated main idea that these underlined details support? a. Smoke jumpers fight fires i

Which form of government did Hobbes think could best maintain social order?

The Rectangles are similar. Find the value of the variable (Picture Included)

Which of the following passages contains a good example of sensory imagery? “The distant sound of a church clock is borne faintly on the wind. You question w

Which perspective claims that poverty is outside of human control?

Coworkers bob and tom were comparing checks on friday. bob saw that tom's was significantly larger, which made bob unhappy. which theory best explains bob's rea

If a sphere has a radius of 2 cm what is the approximate surface area of the sphere

Write the standard equation for the circle center (10,-6), r=6