montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

explain how working with an individual who is distressed may impact on own being

Charlotte was not hungry that morning so she just had a smidgen of cake at the office birthday party. What does smidgen mean?

Why is Lord Byron's "Don Juan" considered a satirical poem?

Which of the following is pop criticism primarily concerned with? - literary analysis of a product -opinion without evidence for a product -advising the pur

How do you justify 10 (y+5) = 10

25mi/hr=_______m/min

Mean number of yards the player runs per quarter -2 14 -18 -6

For football tryouts at a local school, 12 coaches and 42 players will split into groups. Each group will have the same numbers of coaches and players. What is

what is the answer for this

Instructions such as enter, exuent, and retiring are known as