juujuh1 juujuh1

25-10-2020
Mathematics

contestada

find the solution
4x - 7y = 22
x = 2y + 6

Respuesta :

staebilomala staebilomala

25-10-2020

Answer:

y= - 2

Step-by-step explanation:

4 times (2y+6)-7y=22

8y+24-7y=22

y=-2

Answer Link

Otras preguntas

Which table shows positive correlation?

is there any reason to criminalize homosexuality

i really need help please help me

i will give lots of points for these 4 answers

Given the area of a triangle, find the two possible values of an angle. (Also two sides of the triangle is given). You can make up values to find it out.

the ratio of the sides of two similar polygons is 50:21 . the side of the smaller polygon is 11. what is the side of the larger polygon

ممكن حل بسرعة please help

The ratio of girls to boys in a grade is 6 to 5. If there are 24 girls in the grade, how many students are there altogether?

It is recommended that a ramp have at least 8 feet of horizontal distance for every 1 foot of horizontal rise along an incline. The ramp shown has a vertical ri

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT