billyjames1002 billyjames1002

23-11-2020
Physics

contestada

A 100N effort force is applied to a machine and lifts a 400N object. What is the MA of the machine?

Respuesta :

baileywilliams37483 baileywilliams37483

04-12-2020

Answer: dum dum

Explanat

Answer Link

Otras preguntas

Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun

What impact did Babe Ruth have on the society/country?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

The role of media on reporting human rights violation

What is 7 3/4 times 7?

A sales tax of 6% is added to the price of an item.If Marisa buys an item which expression indicates how much she will pay in all.A,n+0.06,B,0.06n,C,n+0.06n or

Which of the following correctly describes SAM, a biological methylating agent? A) It contains a Cl bonded to a 1° carbon. B) It contains a methyl group bonded

The europhoric state caused by is due to a dangerous lack of oxygen to the brain

What is double consciousness

A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.