quanyiloudwGriffan quanyiloudwGriffan

25-10-2016
English

contestada

Why structural words important to build a sentence?

Respuesta :

Noah211 Noah211

25-10-2016

So that the sentence makes sense and so that people understand what you are trying to say in the sentence.

Answer Link

Otras preguntas

When was wheeled traffic permitted in early Rome?

Why was the Soviet Union unable to keep up with the market economies of the west? How did Gorbachev’s reform lead to break up of Soviet empire ? Why were Easter

Guys I need help with this ASAP please if you know help me

12. What type of circuit is the diagram below? series circuit parallel circuit

Suppose we are interested in bidding on a piece of land and we know one other bidder isinterested. The seller announced that the highest bid in excess of $10,00

I need help with these questions please answer :(

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

#1-4: Identify the participle or participial phrase and the word it modified in each sentence. 1. Jon saw a running deer in the forest. 2. The girl playing the

help please its easy but I'm stumped I've been working for hours question in the picture

Dilate the triangle with vertices A (1,2) B(2,4) C(-1,-2) with a scale factor of 2. What would be the new ordered pair for B'?