rajaksandip14581
rajaksandip14581 rajaksandip14581
  • 23-02-2021
  • Physics
contestada

what is gravitational force?​

Respuesta :

EDMP EDMP
  • 23-02-2021

Answer:

It is the force that is present because of the mass of our planet. it's what keeps us stuck on the surface of Earth rather than floating off into space.

Answer Link

Otras preguntas

choose the correct helping verb the tadpoles have or had moved into the pond
Please help me with this question.
Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above
A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius
Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
.Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here
182,886 rounded to the nearest tenth
Joe has eaten of a pizza. Jane has eaten of a pizza How many times more pizza has Joe eaten than Jane?
Please help me with this question.