kraewilli2003 kraewilli2003

23-02-2021
Geography

contestada

Which type of site would have the best-preserved remains?
Waterlogged
Dry
Volcanic ash
Cold

Respuesta :

smithspy01 smithspy01

23-02-2021

Answer:

Volcanic Ash

Explanation:

Please mark brainliest

Answer Link

princesspeach700 princesspeach700

23-02-2021

Volcanic Ash as well

Answer Link

Otras preguntas

1. Explain the different forms of child abuse? Include Shaken Baby Syndrome in your response.

im making a poster for chemistry. the topic is acid and base. i have to make a creative title to go with the poster. any ideas?

The role of media on reporting human rights violation

Consider the following formula used to find the volume of a cone. Which of the following represents the formula that could be used to find the height of the con

Which viruse reproduces & what reproductive cell ?

0-4+7-5×3÷9×5-4 do the sum of that mathematics...

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

find three acids and three bases used in your home. 1) what are theses acids and bases used for? 2)look up the chemical name and chemical formula of each acid a

What does the term human rights mean

When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated