wahab54 wahab54
  • 23-02-2021
  • Mathematics
contestada

1) Find the slope and the y-byintercept of the line that passes through the points (1,5) and (3,9)

Respuesta :

Gbese Gbese
  • 24-02-2021

Answer: slope= 2, y-intercept= 3

Ver imagen Gbese
Answer Link

Otras preguntas

Science cannot describe things that _______________
DNA tacaggtacccgaacccaattta
How did the government ensure workers didn’t strike during the war? Why would a strike hurt the war effort?
Greatest accident risk factors -Poor hazard detection -Low-risk perception -Lack of skill -Risk-taking Most common driving violations -Speeding -Not using tu
Identify and explain the specialization of country alpha and country beta
Could someone help me with this? I need 3 describing the motion of the sun, moon, earth. Please :)The orange is the sunThe blue is the earthThe gray is the moon
The whip tail of a Vinegaroon is a mimic for a scorpion’s pincher claws. Please select the best answer from the choices provided T F
Find the area of the green sector if ∠ A = 45° and the circle has a radius of 10 inches. A)25π B)5π4 C)5π2 D)25π2
What was it's a similarity between the Bill of Rights and the Magna Carta
Three-fourths was subtracted from a number, and then 5/4 was added to the result. The sum was -7.