sisinalyssa sisinalyssa

25-02-2021
Mathematics

contestada

What’s the inverse of :If f evenly divides 40 then f evenly divides 30

Respuesta :

trammelmr trammelmr

25-02-2021

Answer:

the inverse operation would be multiplication

Step-by-step explanation:

Answer Link

Otras preguntas

What is 7 3/4 times 7?

Identify your human rights violation and explain in a introductory paragraph why you choose the specific human rights

of elements N, O, Cl, Na, and Which two would likely have similar chemical properties and why

A red dwarf is _____ A. the remains of a supernova. B. a hot pulsar. C

Perpendicular lines intersect to form __________________ angles

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

A biological membrane is selectively permeable in that it can, to some extent,control which substances pass through it. Based ont he information provided in Boo

How can one concentrate in studies ?

What type of triangle is this?

What is 7 3/4 times 7?