haitian62 haitian62

23-03-2021
Biology

contestada

2.
has no nutritional value.
a. Bread
b. Alcohol
c. Meat
d. Milk

Respuesta :

Voyager5081 Voyager5081

23-03-2021

Answer:

alcohol

Explanation:

it has only bad effects on the person who drinks it

Answer Link

Otras preguntas

The term racial unconscious means that

Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Chloe’s mother wants to have another child. However, she is concerned that a second child might also have CF, so she encourages Chloe’s stepfather to be tested.

HELP ASAP!!!!!!!! PLEASE!!!!!! Why does Ralph become the leader of the group at the beginning of the novel? A. because Ralph is manipulative and po

1) If X = 2, calculate the value of: 2x squared - x 2) if X = -2, calculate the value of: 2x squared -x

how to get the answer to this equation 1+4=5 2+5=12 3+6=21 8+11=?

Consider the combustion of octane (C8H18) 2C8H18+25O2-> 16CO2+18H2O How many grams of CO2 are produced when 191.6g of octane are burned?

I Prove that Cos(90-θ)/1+sin(90-θ) +1+sin(90-θ) /cos(90-θ) =2

Which force brought together the material from the nebula to form the solar system? A. electromagnetism B. strong nuclear force C. weak nuclear force D. g