tanyasingh21
tanyasingh21 tanyasingh21
  • 26-03-2021
  • Biology
contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946
annaclaire946 annaclaire946
  • 26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

What government has one person making all the decisions with one hundred percent power
You receive an invoice for $565.00 with terms 3/10, net 30. If you pay it immediately, how much will you pay? A. $551.25 B. $558.05 C. $548.05 D.
A county commission is considering assessing a tax on residential water use above a certain amount. What might this tax be trying to discourage? A- watering of
When it is spring in the Northern Hemisphere, what season is it in the Southern Hemisphere? A. spring B. summer C. fall D. winter
what happens to food energy during photosynthesis
The person holding the position of ______ in the House or Representatives is primarily responsible for persuading members of his or her party to vote accordin
Which number represents an acidic pH, 4 or 9? ______
If h(x) = 6 – x, what is the value of (h*h)(10)?
What is the difference between a vocational school and on the job training
the ancient chinese wear eager to share the art of silk production with other cultures A.True or B.False