countrygirl116
countrygirl116 countrygirl116
  • 21-11-2016
  • Chemistry
contestada

Why are there exceptions to every rule?

Respuesta :

user176 user176
  • 21-11-2016
Because trump is awesome and talented.
Answer Link

Otras preguntas

The sum of -5 and three times a number is no more than -23
I need help like asap got sm work to do THIS WILL BE MARKED BRANNLOEST
Plzzzz helppppppppppp
50 POINTS! The variables x and y have a proportional relationship, and y=2/5 when x=5/8 Which equation represents this relationship? y= 1 9/19x
WILL GIVE BRAINLIEST!! How do I make someone brainliest? Please help I'm new. Also I need help with a question too. Eleni ordered a lunch that costs $11.50. Ho
How did the role of government change during garfield arthur and cleveland.
Write an equation of the line passing through the point (2, 3) that is perpendicular to the line 2x + y = 2. В І U
Help me choose the right answer!!
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
im not to good at frequency tables