kiratibollineni kiratibollineni
  • 24-04-2021
  • Mathematics
contestada

Sketch the graphs y=lxl, y=lxl+1 and y=lxl-2

Respuesta :

gufeliz1965
gufeliz1965 gufeliz1965
  • 24-04-2021

Use Desmos to graph all three absolute value functions on the same xy-plane.

The function y = |x| looks like the letter V where both lines meet at the origin.

Answer Link
brittneycobb516 brittneycobb516
  • 25-04-2021
i would recommend Desmos but |x| makes a parabola (which kinda looks like a V or U) and the number to the right would change where parabola is located on the graph. The point where it curves would be a y=1 and y=-2
Answer Link

Otras preguntas

List and describe 3 molecular methods used to analyze DNA in a laboratory.
1+4 = 5. 2+5=12. 3+6=21 8+11==?
If y= 4x +5 has a gradient of 4 write the equation of a line parrellel to it?
A machine drops 74 milliliters of liquid into a beaker every minute. Using an empty beaker, Sarah started the machine and left the room. When she returned, the
A cargo plane flew to Moscow and back. It took six hours longer to go there than it did to come back. The average speed on the trip there was 152 mph. The avera
what is the main point being made by the cartoonist documeny E
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what came first the chicken or the egg
Find the mean of these values 6,4,8,2,5
what procedure could you use to test the effect of a catalyst on a reaction