gohh93960 gohh93960
  • 25-04-2021
  • Mathematics
contestada

Factor the following : x(x + 5) + 3(x + 5)

Respuesta :

melaaatt
melaaatt melaaatt
  • 25-04-2021
x(x+5) + 3(x+5)
x²+5x + 3x+15
x² + 8x + 15
Answer Link

Otras preguntas

During a cesarean section, an incision is made through all EXCEPT which of the following? A)linea alba B)perimetrium C)superficial fascia D)decidua basalis
explain the conditions for cloud formation
what is 7/8ths of 40
Pythagorean Theorem: Alex leaves home, travels 5 miles east, and arrives at the library. He leaves the library and travels 3 miles north to a friend's house.
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Select all that apply. Select all the correct statements about ion sizes below. Check all that apply. Au3+ is smaller than Au+ As3− is smaller than P3−. Au+ is
14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?
. Green swordtails are sexually dimorphic: males have a long, swordlike projection from their tails, and females have rounded tails. An experimenter decides to
How do short-term goals differ from long-term goals?
Could someone help with the questions in the images below? Some I have already completed - please let me know if they are right! and the others are blank.