destonyyy1 destonyyy1
  • 26-04-2021
  • Chemistry
contestada

A cation with a +4 charge has 26 neutrons and 18 electrons. What is the identity of the element?

Respuesta :

keijosalonen
keijosalonen keijosalonen
  • 09-05-2021

Answer: Titanium has 22 protons

Explanation:  If an atoms donates 4 electrons, it forms cation with charge +4. So original atom have 22 electrons and because atom is neutral, it has 22 protons. Number of neutrons does not matter, there are more neutrons than protons  in heavier atoms.

Answer Link

Otras preguntas

Last question i need help on. Again ik its sunday but i got sick bad over the weekend. Incase the question is hard to read it says “ solve each equation for X.
If α and B are roots. of the quadratic equation 3x²+2x+7=0, find the quadratic equation whose roots are a+1/b and b+1/a
17. Priti wants to wish her 5 subject teachers by giving them a self-made greeting card on Teacher's day. She has chosen a green colored square sheet of paper.A
For what x,y the number xxyy is a perfect square?
County fairs can be really fun.
What do you think are the five most important facts that a person should know about metamorphic rocks?
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Divide. Round your answer to the nearest hundredth. 0.784 9,091.9534
The longer Abu-Lughod stayed in the Bedouin community, the more she was seen as a daughter of the family. What were the expectations of her as an adopted daught
The graph of a parent function is shown helpppo please