kimberly2535
kimberly2535 kimberly2535
  • 21-05-2021
  • Mathematics
contestada

PLEASE HELP ASAP!! will mark brainlest

PLEASE HELP ASAP will mark brainlest class=

Respuesta :

tlilyan173 tlilyan173
  • 21-05-2021

Answer:

B!!!!!

Step-by-step explanation:

Answer Link

Otras preguntas

Indigenous North American societies recognized and even valued a gender status known as (Points : 1) intersexuality. Two Spirits. Hij
1) A fashion designer makes and sells hats. The material for each hat costs $5.50. The hats sell for $12.50 each. The designer spends $1400 on advertising. How
Which best describes the climax of the Odyssey? A. Odysseus kisses the ground as his journey home comes to an end. B. Odysseus sees Telemachus for the fir
what is the property of 6x=72
I need help with this quickly please
help answer ASAPPP 10 points
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
State two biological reasons why you consider that the loss of biodiversity matters.
State two biological reasons why you consider that the loss of biodiversity matters.
what are the 3 care instructions for future life on earth