codingqueen4000 codingqueen4000

21-05-2021
History

contestada

Question: Use the map to help answer this question.

In which areas was gold was found?

Question Use the map to help answer this question In which areas was gold was found class=

Respuesta :

crazycrash782 crazycrash782

21-05-2021

Answer: around sacramento and sn fran

Explanation:

Answer Link

Otras preguntas

Which sentence uses correct punctuation? Use the "Basic Mechanics Resource" if needed. The Mariana Trench is one of the most difficult geographical areas' to ac

Name: PLOTTING Answer each question below usin 1. Which quadrant(s) include cities that will experience a total solar eclipse?

38 39 40 41 42 43 44 45 46 47 48 49 50 A square has an area of 45 cubic units. What is the perimeter of the square? A 90 units B 125 units C 24√5 units D 365 un

Write two behavioral and two situational interview questions for selecting a candidate, including examples of ideal responses for each type.

Can someone please help me with these questions

Derive the Black-Scholes formula for the European Put option. Proceed along the lines of the corresponding calculations for the European Call option presented i

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

What was the legal issue in this case? What did the court decide? From the evidence presented, when were the business circumstances causing the mass layoff reas

A 330g volleyball is thrown vertically upward with a speed of 1.50 m/s. It takes the ball 0.8s to reach the ground. What is the magnitude of its momentum just b

meaning of compound - complex sentence with examples