laraueeeee laraueeeee

24-07-2021
Mathematics

contestada

Qual o valor da expressão? 155÷2+4−55+1,5−6×5+6?

Respuesta :

Аноним Аноним

24-07-2021

Answer:

Step-by-step explanation:

Hello!

(155/2)+4−55+1,5−(6×5)+6=

77,5 +4-55 +1,5 -30 +6= 4

Answer Link

Otras preguntas

Can someone plllllease write me a thesis statment for this : How can we do a better job at fixing metro buses so people can go to their location on time???

A Carpenter who is installing cabinets uses thin pieces of material called shims to fill gaps. the carpenter uses four shims to fill a gap that is 1.2 centimete

Which number has the greatest absolute value? A. 7 B. –21 C. 18 D. –15

What is the effect of pressure on the volume of a gas?

Solve the following proportion problem for x: 14/3x=20/x-5

Eric greets MarÃa as shown below. At what time of the day is he greeting her?

Pamela: ¿Qué te aconsejó el médico para el dolor de tu rodilla? Ricardo: Me aconsejó tomar _____________________. A. unos analgésicos B. una cir

the sum of two number is 14 and their difference is 10 then what will be their multiplication

DNA tacaggtacccgaacccaattta

Which statement best summarizes the information on these graphs? Many Bolivians are farmers, but the agriculture sector does not produce much in terms of GDP. I