kmcgalis001 kmcgalis001

25-10-2021
Mathematics

contestada

Will offer 40 points for answer
Help with math question it’s in the image

Will offer 40 points for answer Help with math question its in the image class=

Respuesta :

aehockaday aehockaday

25-10-2021

I think it’s the first one because you mirror ABC from the m-axis and then rotate ABC 90 degrees clockwise from point B’ to get to the position of triangle A”B’C”

Answer Link

Otras preguntas

Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?

of elements N, O, Cl, Na, and Which two would likely have similar chemical properties and why

When a cell related to immunity activates only in reaction to a specific pathogen, it is called _____. (Points : 4) inducibility clonality lymphocytes T lymphoc

why can't the position of an electron be determined with certainty?

what do you think accounts for algerias score it has received in recent years on government stability and the absence of violence

if an element has more than one ionic caves how was that piece of information represented in a chemical name?

The Glorious Revolution of 1688 demonstrated that Parliament had

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Do any of these represent a linear function (just state letters if they do)

can organisms naturally repair a mutation?