lonapayso1 lonapayso1

24-02-2022
Mathematics

contestada

1.502 x 10 of the power of 6 ???

Respuesta :

Аноним Аноним

24-02-2022

Answer:

1,502,000

Step-by-step explanation:

10^6 is 1,000,000

and 1,000,000 x 1.502

= 1,502,000

Hope this helped! Have a nice day!

PLease give brainliest when possible!

:3

Answer Link

Otras preguntas

Translate these lines from the poem. "Bot wold ye, lady louely, then leue me grante Nay, for sothe, beau sir, sayd that swete" WOW, I'M LOST!! #ihatemyenglishc

what number should be added to the expression to turn it into a perfect square trinomial x^2+2x

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

can organisms naturally repair a mutation?

Work out the Hcf of 32 and 36

Which one of the following statements expresses a true proportion? A. 2 : 3 = 3 : 2 B. 3 : 5 = 12 : 20 C. 42 : 7 = 6 : 2 D. 14 : 6 = 28 : 18

I need help with this. thank you!

Joe made 15 points in a basketball game, 3 points are given for a long shot, 2 points given for a field goal, and 1 point is given for a free throw. In how many

87.5 of what number is 315

7. Which of the following rivers is the world's busiest waterway? A. Rhone B. Rhine C. Danube D. Seine