wwwwqqqwwqwwwqwq23
wwwwqqqwwqwwwqwq23 wwwwqqqwwqwwwqwq23
  • 24-02-2022
  • Mathematics
contestada

Calculate the difference -10 -6



Respuesta :

Mxnxhil
Mxnxhil Mxnxhil
  • 24-02-2022

Answer:

is this -10 - 6 because if it is then its -16 but if ur finding the difference of negative 10 and negative 6 then it would be -4

Step-by-step explanation:

Answer Link

Otras preguntas

Why did the British parliament pass the intolerable acts?
What is the equation for the line described in #9And #10?
is the pair of complementary angles are in the ratio4:11 find them​
Critics of trade barriers argue that trade barriers __________. a.) reduce the domestic incentive for production efficiency b.) are politically too easy to remo
WILL GIVE BRAINLIEST
Help help help history
Given that f(x) = x² + 5x, evaluate f(-2).If g(x)=2x + 1, find g(a + h)- g(a).
- Are the lines y = -1 and x = 1 parallel?
Hemp bell bell help math
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):