kalasmith9721 kalasmith9721

23-03-2022
Mathematics

contestada

Kayla has 8 apples. she wants to give 3 fourths of the apples to her friends.
how many apples will her friends get?

Respuesta :

puppycatfanz puppycatfanz

23-03-2022

Answer: 6 apples

Step-by-step explanation:

Number of apples divided by denominator times the numerator

8÷4=2×3=6

Answer Link

Otras preguntas

If Ms. Walker runs at a pace of 2 laps per minute, which expressions represents this situation? Let m represent the number of minutes Ms. Walker runs at this pa

The proteome solution was fractionated by ion-exchange chromatography. What type of ion-exchange resin will bind RNAP at pH 7.4

Which layer of rock is the oldest? 1. Layer A 2. Layer D 3. They are all the same age 4. There is not enough information to answer this question

Why did colonists oppose the Townshend Acts?

What is the problem with the bonding of two nitrogen atoms ?

What type of political group did Hitler join when the war ended? Why?

Role of nitrogen in air?

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

The means by which energy is made available to a cell is called _____. a. digestion b. dietary supply c. metabolism d. caloric availability

How did Hitler imagine the future of Germany?