HannahJohnsonLove HannahJohnsonLove
  • 21-05-2017
  • English
contestada

"Going faster than a rolelrcoaster"

is what?

similie
metaphor
personification..

which one of those three would it be? Or would it be something else

Respuesta :

TheTyeDyeTaco
TheTyeDyeTaco TheTyeDyeTaco
  • 21-05-2017
That would be a perfect example of a metaphor. a simile uses "like or "as". and a personification gives a non-human object human traits for example "the lightning danced across the sky", the lightning is not really alive and dancing....if that makes sense....the answer is metaphor. :)
Answer Link

Otras preguntas

7.8 14. Give the inequality 7.9 15. Make d the subject of the formula: A cd Anyone know the answers to these two questions?
Which university was the first to grant a woman a Ph.D. in America?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Who is Barbare Sonek?
Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above
1.What process is used to replicate the chromosomes? 2.Are the sister chromotids genetically identical? Explain.
Which of the following tactics do food manufacturers use to try to get you to buy their products? a. TV and radio commercials b. all of the above c. coupons d.
why did the united states fail to join the league of nations
what the decimal of 2 1/4
Cardiac muscle contracts A. in response to voluntary output B in response to nonvoluntary input C. on its own without input