alexmm6565 alexmm6565
  • 24-01-2024
  • Mathematics
contestada

What's the product of 7 and y then translate the phrase into an algebraic expression

Respuesta :

Otras preguntas

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
A note on the 4th line sounds ______________ than a note on the 2nd line.
A. 1/12 B. 8/3 C. 7/12 D. 1/4
Which principle of sports rule provides the opportunity for equal competition for everyone?
Explain the concept of optimum environment for enzyme function
As it heats, does fluid rise or compact s
which type of pronoun is used to stand for a person, place, or thing that is completing an action.
Cars arrive at a highway toll booth according to a Poisson distribution with a mean of 90 cars per hour. The service rate for passing through the booth is also
Question 3 of 10 When we "read" visual and audio texts, we A. group letters into words that form sentences and paragraphs, B. try to understand and interpret ma
9.50 dollars the hour times 14.5 hours