gangplankship gangplankship
  • 23-02-2024
  • English
contestada

gusto ko Lang na an mag lambing in english

Respuesta :

alexisolea410 alexisolea410
  • 23-02-2024

Answer: "I just want someone to show affection."

Answer Link

Otras preguntas

I Prove that Cos(90-θ)/1+sin(90-θ) +1+sin(90-θ) /cos(90-θ) =2
A number tripled and tripled again is 729 what is the number
Piaget believed that language helped foster cognitive development. Please select the best answer from the choices provided True or False
If 1+4=5 what is 8+11
Perpendicular lines intersect to form __________________ angles
Why it is not possible to draw a square that is not a parallelogram
How many times dose 63 go into 359
What are the three differences between The Quran and the Gospel??
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
In a cell if ΨP = +0.3MPa and ΨS=-0.45MPa, then the resulting Ψ is ___. Enter your answer with either a + or a - before the number and no words.