bethanydavidson8170 bethanydavidson8170
  • 22-09-2017
  • Geography
contestada

What area of the country is the main benefactor of the electricity generated by the hoover dam? 583 points?

Respuesta :

meerkat18
meerkat18 meerkat18
  • 06-10-2017
Southern California is the main benefactor of the electricity generated by the Hoover Dam.

Hoover dam was begun under the administration of President Herbert Hoover but completed as public works during the Roosevelt administration. Hoover dam became part of a much larger multipurpose water development project that tamed the wild Colorado River.
Answer Link

Otras preguntas

Simplify 3 square root of 5 end root minus 2 square root of 7 end root plus the square root of 45 end root minus square root of 28.
Why is the slide on the right considered more eye-catching and visually appealing than the slide on the left? Select all that apply. It uses analogous text colo
Which of the following are distinctive features of the Australian ballot? Select all that apply. 1) it is an open ballot 2) names of all candidates appear on a
Which English king turned the new England area into one colony for better control? A) king james llB) king Williams C) king Henry
find the area and perimeter of abcd
answer this please!!!!
how many fiths are eqivalent to 12/20
what was the main reason the united states entered the war according to Wilson
Which number is a rational number, an integer, and a whole number?
DNA tacaggtacccgaacccaattta