jacilynn3048 jacilynn3048

25-09-2017
Social Studies

contestada

Sigmund freud's psychoanalytic theory of personality is built on the premise that ________ are at the heart of human motivations and personality.

Respuesta :

Jorgelopez9 Jorgelopez9

25-09-2017

the answer is D hope i helped

Answer Link

Otras preguntas

Here are 8 visual contents from the internet. Identify their implications to an individual or society.

Tony brought 9 2/3pitchers of juice to a volleyball game, and the players drank3 7/8pitchers of it. How much juice is left?

The three greater than signs (>>>) are called the python.

How does your body respond to an increase in the waste products of energy production

9- Under what circumstances would a vector have components that are equal in magnitude? a. if the vector is oriented at 45° from the axes. b. if the vector is o

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Simplify the expression by combining like terms. 6x + 9 + 2x + 4 Does anyone know the answer?

Consider the equation -12x+4y=48=0 find the y value and the y intercept of the line.

The Reformation was a period in history that emphasized knowledge, learning and understanding of science, governments and natural rights. A: True B: False

amelia sells jewelry. she earns 12% commission on her sales , and a weekly salary of 550. how much did amelia earn this month if she sold 22,540 worth of jewelr