moneyboy6436 moneyboy6436

24-10-2017
Mathematics

contestada

A circle has a radius of 6cm . find the length s of the arc intercepted by a central angle of 169° .

Respuesta :

AldyTrigg1 AldyTrigg1

27-10-2017

The circumference of the circle is = 2 x pi x 6 = 37.7cm

To find the arc = 360 divided by 169 = 2.13

The arc = 37.7 divided by 2.13 = 17.69 cm

Answer Link

Otras preguntas

What is 7 3/4 times 7?

Marley has read 112.5 pages of a book. By the end of today, she plans to have read at least a total of 360 pages. If she reads 45 pages per hour, what is the mi

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Which one of the following statements expresses a true proportion? A. 2 : 3 = 3 : 2 B. 3 : 5 = 12 : 20 C. 42 : 7 = 6 : 2 D. 14 : 6 = 28 : 18

Please answer and put how

a water sample could be negative for enterococcus and coliforms and still be a major public health threat. why? Why can filitration be used to sterilize culture

A storage unit is in the shape of a cube with 8 feet edge lengths what is the surface area of the storage unit

Make a phrase with each of them for me please 1) Beneficial 2) benefited 3) Breath 4) Brilliant Thank you so much ! Please , no grammars mistakes

im making a poster for chemistry. the topic is acid and base. i have to make a creative title to go with the poster. any ideas?

Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?