croitru7857 croitru7857
  • 25-02-2018
  • Biology
contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422
  • 25-02-2018
gtaaccatccgttttcttga
Answer Link

Otras preguntas

The area of a circle is 12.56 square miles. What is the circle's radius?Use 3.14 for
What are two ways in which the suns energy can be captured and used?  How can both be used in a home?
A rectangular room is 6 yards long an 12 feet wide.  Find the perimeter in feet.  Then find the perimeter in yards.
explain why each mineral has its own properties, different from every other mineral.
how to solve 2/4 of 4
Which kind of bonds are most easily broken in water? a. ionic b. peptide c. disulphide d. single covalent e. double covalent
Which three ordered pairs complete the table to give solutions of the equation y = x – 7?  A.(3, –10), (0, –7), and (3, 4)  B.(–3, –10), (0, –7), and (3, –4)  C
what is the answer for 6r^2-10r-24
what is the answer for:   r = 9 ft r = 21 m d = 30 cm  d = 24 cm r = 15.2 in r = 16.01 ft    please answer them i just want the answer like example the answer f
Who is Henry the 8th and what is his hstory