kukisbae kukisbae

22-03-2018
Mathematics

contestada

Given the following graph of a system of inequalities, the point (3, 2) _____________.

Given the following graph of a system of inequalities the point 3 2 class=

Respuesta :

MrGumby MrGumby

22-03-2018

That point does not satisfy either inequality.

You can tell it does not satisfy the first portion, due to it being under the shaded line. Secondly, the dotted line goes through it, but that fact that it is dotted makes it not included.

Answer Link

Otras preguntas

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

Name three forms of government assistance programs that undocumented residents can qualify for in the US?

chocolate brownie recipe is as follows: 200 g chocolate, 4 eggs, 60 g flour, 60 g cocoa, 100 g butter, 250 g sugar, The recipe makes 24 brownies. Sarah is

please help due at 11 !! thank you so much

i’ll mark as brainliest if correct

please help someone i need a poem like this

For what value of x do the expressions 2x+3 and 3x-6 have the same value?

ASAP What is net plz help due today

Metallica Bearings, Inc., is a young start-up company. No dividends will be paid on the stock over the next nine years because the firm needs to plow back its e

What was Texas's MAIN contribution to WWI?