aleenrose3632 aleenrose3632

23-03-2018
Biology

contestada

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?

Respuesta :

NAWty12345 NAWty12345

28-03-2018

A gene instructs for the making of protein molecules.
Please make brainliest!☺

Answer Link

Otras preguntas

in which was did america experience a direct military attack upon its own territory?A.ww1 B.ww2 C.vietnam war D.all of the above

Consider the following reaction: 2HCl + Ca(OH)2 CaCl2 + 2H2O A scientist wants to neutralize 25 mL of 0.001 M Ca(OH)2 with a volume of 0.005 M HCl. What is th

Gary wanted to determine the average height of boys at the high school. his older brother is on the basketball team, so he asked him to measure his teammates. a

When a person contracts and gets a cold or infection what type of immunity is this?

What length is the shorter leg of a right triangle that has hypotenuse 50 in long and its perimeter is 112 inches?

Mrs. And Mr. Smith both have widow's peaks (dominant). Their first child also has a widow's peak, but their second child doesnt. Mr. Smith accuses Nrs. Smith of

the circumference of a motor bike wheel is 40cm how much distance does it cover in two full rotation

Fiona plants some seeds in different pots. All of the pots have the same soil. She gives them the same amount of water and air. Where should Fiona put the plan

Henry has 5 dimes. Ben has 9 dimes. Tina has 2 dimes. a. Write the value of each person's money as a fraction of a dollar. Henry: Ben:

A rectangular box with a volume of 500 ftcubed is to be constructed with a square base and top. the cost per square foot for the bottom is 15cents, for the top