anfrony7oh7 anfrony7oh7

25-04-2018
Mathematics

contestada

What is the rule for rotation 90 degrees counter clockwise

Respuesta :

lisalavenp6y00c lisalavenp6y00c

25-04-2018

(-y, x). When we rotate a figure of 90 degrees counterclockwise, each point of the given figure has to be changed from (x,y) to (-y,x) and graph the rotated figure

Answer Link

Otras preguntas

As a member of the Feel Power.org team, Noah explains, "I like to teach kids because I feel like I have good mentors in my life. A lot of kids don't have that,

To whom do you go if you wish to enroll in a college saving plan?

Carla chose a number between 1 and 50 and then described to henry how he could determine the number she chose.Carla's says "if you subtract 5 from my number,mul

Mr. Murray wants to create 100 ounces of a mixture that is 62% pecans, 30% almonds, and 8% walnuts. How will the amount of Mixture A compare to the amounts of M

What is the surface area of the figure shown? 989.1 square centimeters 910.6 square centimeters 1,852.6 square centimeters 832.1 square centimeters

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Explain how a hormone may cause its effect on plant growth and development.

Simplify the expression so there is only one positive power for each base (3^-2•7^-5)^-4

According to mcclelland's acquired-needs theory, people who need personal _____ want to direct others and can be seen as bossy.

Identify 3 uses of money and give an example of each